ID: 1021237997_1021237999

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1021237997 1021237999
Species Human (GRCh38) Human (GRCh38)
Location 7:18166813-18166835 7:18166832-18166854
Sequence CCAGGACAAAGCTACAAACAAAT AAATATCATAATGTCCAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 188} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!