ID: 1021240690_1021240698

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1021240690 1021240698
Species Human (GRCh38) Human (GRCh38)
Location 7:18197063-18197085 7:18197107-18197129
Sequence CCCCCCTTATGTAAGAGAGAATT ACTGGGACATTGACCATTACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 32, 4: 224} {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!