ID: 1021279096_1021279102

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1021279096 1021279102
Species Human (GRCh38) Human (GRCh38)
Location 7:18694797-18694819 7:18694827-18694849
Sequence CCCTCCAGTTTATGCAAATGGAA TTCAAAGGGACAATATCCTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 144}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!