ID: 1021279782_1021279790

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1021279782 1021279790
Species Human (GRCh38) Human (GRCh38)
Location 7:18703734-18703756 7:18703759-18703781
Sequence CCTCTCCTTCCAGAAATAACCCC ATCCCCATCCCTGTCCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 248} {0: 1, 1: 0, 2: 6, 3: 52, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!