ID: 1021299315_1021299316

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1021299315 1021299316
Species Human (GRCh38) Human (GRCh38)
Location 7:18952737-18952759 7:18952784-18952806
Sequence CCACATTTTAAAAAATGATTTTA AACCTTGTACTGCCACAGAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 40, 3: 332, 4: 2148} {0: 1, 1: 0, 2: 0, 3: 11, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!