ID: 1021313017_1021313029

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1021313017 1021313029
Species Human (GRCh38) Human (GRCh38)
Location 7:19116457-19116479 7:19116492-19116514
Sequence CCAGGGCGCATCCCCCTGGAGAC CGGGGTCAGACCGGCCTTCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115} {0: 1, 1: 0, 2: 0, 3: 14, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!