ID: 1021391853_1021391858

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1021391853 1021391858
Species Human (GRCh38) Human (GRCh38)
Location 7:20102622-20102644 7:20102641-20102663
Sequence CCTGACTGGCTCAAACCATGGGT GGGTGGGACAAGATAAATTAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!