ID: 1021401400_1021401402

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1021401400 1021401402
Species Human (GRCh38) Human (GRCh38)
Location 7:20213532-20213554 7:20213557-20213579
Sequence CCATAATGATGGACTGGATAAAG AATGTGGTACATATACACCATGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 81, 3: 198, 4: 294} {0: 3058, 1: 26518, 2: 15879, 3: 9004, 4: 6202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!