ID: 1021413540_1021413548

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1021413540 1021413548
Species Human (GRCh38) Human (GRCh38)
Location 7:20355333-20355355 7:20355373-20355395
Sequence CCTCACTGCCTGTCCCAGTAAAT TACTCTAGGGTCTTTCTCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 306} {0: 1, 1: 0, 2: 2, 3: 9, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!