ID: 1021446140_1021446148

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1021446140 1021446148
Species Human (GRCh38) Human (GRCh38)
Location 7:20735735-20735757 7:20735764-20735786
Sequence CCAGCCAGCTTTCCACTGCAAGG ATGTAGGGGAAAACACAGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 32, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!