ID: 1021451052_1021451059

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1021451052 1021451059
Species Human (GRCh38) Human (GRCh38)
Location 7:20784426-20784448 7:20784451-20784473
Sequence CCGCCGCCGCCGCCGCCGCCACT GCGTCTTCACGTGCTTGCTGAGG
Strand - +
Off-target summary {0: 17, 1: 224, 2: 1709, 3: 2660, 4: 4886} {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!