ID: 1021456762_1021456765

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1021456762 1021456765
Species Human (GRCh38) Human (GRCh38)
Location 7:20837885-20837907 7:20837931-20837953
Sequence CCTTCCTATAAAATTTAGTCGTG AATTAAAAGCAGATGCTGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 36, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!