ID: 1021493498_1021493504

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1021493498 1021493504
Species Human (GRCh38) Human (GRCh38)
Location 7:21246593-21246615 7:21246608-21246630
Sequence CCAGGCAGAGGCGCTCCTCACTT CCTCACTTCCCAGATGGGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!