ID: 1021500513_1021500518

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1021500513 1021500518
Species Human (GRCh38) Human (GRCh38)
Location 7:21328301-21328323 7:21328353-21328375
Sequence CCAGCCTGATTGGTTGTGGGATG TCTGCCACACAGAAAAAGGAGGG
Strand - +
Off-target summary No data {0: 2, 1: 6, 2: 24, 3: 79, 4: 399}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!