ID: 1021529847_1021529857

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1021529847 1021529857
Species Human (GRCh38) Human (GRCh38)
Location 7:21632215-21632237 7:21632243-21632265
Sequence CCTGGCCCAGGAAACCCCTTTTT GAGGCCTCCAGGACTGAGATGGG
Strand - +
Off-target summary {0: 1, 1: 19, 2: 244, 3: 688, 4: 1800} {0: 1, 1: 0, 2: 12, 3: 509, 4: 1120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!