ID: 1021531123_1021531126

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1021531123 1021531126
Species Human (GRCh38) Human (GRCh38)
Location 7:21646612-21646634 7:21646636-21646658
Sequence CCAGGCCTGGGGAAAGAACTATC GGTGCCCAGTGAGCTCCAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 177} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!