ID: 1021539489_1021539493

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1021539489 1021539493
Species Human (GRCh38) Human (GRCh38)
Location 7:21741650-21741672 7:21741671-21741693
Sequence CCCTCATACTTTAGGGCCTGCAG AGAGTTTATGGCAAAGTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93} {0: 1, 1: 0, 2: 1, 3: 25, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!