ID: 1021539634_1021539644

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1021539634 1021539644
Species Human (GRCh38) Human (GRCh38)
Location 7:21742942-21742964 7:21742992-21743014
Sequence CCTGGTCTCTGCTTCCAAAATGG CAGAAAGGACAGAGCAAATCGGG
Strand - +
Off-target summary {0: 3, 1: 35, 2: 100, 3: 191, 4: 462} {0: 1, 1: 0, 2: 2, 3: 23, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!