ID: 1021542034_1021542040

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1021542034 1021542040
Species Human (GRCh38) Human (GRCh38)
Location 7:21770541-21770563 7:21770562-21770584
Sequence CCAGCCTCATGAGGAGGGACCAG AGTAGTTTCCCCTGGGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 178} {0: 1, 1: 0, 2: 1, 3: 19, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!