ID: 1021559464_1021559470

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1021559464 1021559470
Species Human (GRCh38) Human (GRCh38)
Location 7:21955495-21955517 7:21955511-21955533
Sequence CCTTCCTCCCACATCCCTTCCTC CTTCCTCCTTCCTTAACCCCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 50, 3: 408, 4: 2981} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!