ID: 1021566883_1021566886

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1021566883 1021566886
Species Human (GRCh38) Human (GRCh38)
Location 7:22024918-22024940 7:22024938-22024960
Sequence CCATGCCATGCTGTGCTCAGCAC CACTGCCCAACAGTGCAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 352} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!