ID: 1021626239_1021626251

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1021626239 1021626251
Species Human (GRCh38) Human (GRCh38)
Location 7:22595724-22595746 7:22595767-22595789
Sequence CCCTGCAGGGTGAGGCAATCCTG AGGAGAAGAGGGGGCCTGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 77, 4: 727}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!