ID: 1021627645_1021627653

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1021627645 1021627653
Species Human (GRCh38) Human (GRCh38)
Location 7:22610081-22610103 7:22610123-22610145
Sequence CCAACTTCTCTCCATCTCCACTA CGCTTCTCTCCTGAACTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 28, 3: 150, 4: 802} {0: 1, 1: 0, 2: 0, 3: 14, 4: 245}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!