ID: 1021663182_1021663190

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1021663182 1021663190
Species Human (GRCh38) Human (GRCh38)
Location 7:22942524-22942546 7:22942549-22942571
Sequence CCACCAGAATACTCCAGGCCGTT GTTTTCAAATGTGAGAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88} {0: 1, 1: 0, 2: 0, 3: 25, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!