ID: 1021668771_1021668777

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1021668771 1021668777
Species Human (GRCh38) Human (GRCh38)
Location 7:23014063-23014085 7:23014080-23014102
Sequence CCATCTTCCCCCTCCTCTCACTG TCACTGACTGACAACCCAGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 22, 3: 136, 4: 1425} {0: 1, 1: 0, 2: 1, 3: 7, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!