ID: 1021687971_1021687985

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1021687971 1021687985
Species Human (GRCh38) Human (GRCh38)
Location 7:23206050-23206072 7:23206085-23206107
Sequence CCCTCTGCCCTGCAGACACGGGG GCTGCCCACTGGCCGGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 310} {0: 1, 1: 0, 2: 3, 3: 29, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!