ID: 1021700378_1021700379

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1021700378 1021700379
Species Human (GRCh38) Human (GRCh38)
Location 7:23314001-23314023 7:23314018-23314040
Sequence CCATGAGACATCAGTTGCATTTT CATTTTTCTTTCCTTTTTGTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 42, 3: 410, 4: 3006}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!