ID: 1021705463_1021705473

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1021705463 1021705473
Species Human (GRCh38) Human (GRCh38)
Location 7:23363473-23363495 7:23363520-23363542
Sequence CCAGATTCAAGGGATCATCCCAG TACAGGCGTGACCCAGCACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 41, 3: 272, 4: 694}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!