ID: 1021731261_1021731276

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1021731261 1021731276
Species Human (GRCh38) Human (GRCh38)
Location 7:23597629-23597651 7:23597681-23597703
Sequence CCAGCCGGGCCCGCACCTCTCGC CCCCGCCGCGCCCCCGTCCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 242} {0: 1, 1: 1, 2: 18, 3: 150, 4: 928}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!