ID: 1021737897_1021737899

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1021737897 1021737899
Species Human (GRCh38) Human (GRCh38)
Location 7:23657140-23657162 7:23657155-23657177
Sequence CCTGCTCGTGGCAGGGGTATGAA GGTATGAAGGCACCCCAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!