ID: 1021740259_1021740262

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1021740259 1021740262
Species Human (GRCh38) Human (GRCh38)
Location 7:23679874-23679896 7:23679913-23679935
Sequence CCTGTTATATGCAAGGCACTGCA TAATTTACAAGAAGACTCGCCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 2, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!