ID: 1021743975_1021743982

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1021743975 1021743982
Species Human (GRCh38) Human (GRCh38)
Location 7:23719668-23719690 7:23719721-23719743
Sequence CCCCACCCACTGGTATAAAACAG CTGAAATATCCTCACTTACTTGG
Strand - +
Off-target summary No data {0: 1, 1: 5, 2: 3, 3: 9, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!