ID: 1021787693_1021787697

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1021787693 1021787697
Species Human (GRCh38) Human (GRCh38)
Location 7:24168852-24168874 7:24168867-24168889
Sequence CCCAAATTTATTATTTTATAGTT TTATAGTTCTGTAGGTTAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 44, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!