ID: 1021814304_1021814308

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1021814304 1021814308
Species Human (GRCh38) Human (GRCh38)
Location 7:24432724-24432746 7:24432763-24432785
Sequence CCTGTTATATGCAAGGCACTGCA TAATTTACAAGAAGACTCGCGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 6, 3: 80, 4: 494} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!