ID: 1021828208_1021828213

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1021828208 1021828213
Species Human (GRCh38) Human (GRCh38)
Location 7:24574367-24574389 7:24574416-24574438
Sequence CCGTGTGGTGACAGGATGTGGAT GGACTTTTTAACACTTTACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 125} {0: 1, 1: 0, 2: 0, 3: 14, 4: 162}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!