ID: 1021842163_1021842168

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1021842163 1021842168
Species Human (GRCh38) Human (GRCh38)
Location 7:24729613-24729635 7:24729640-24729662
Sequence CCTTCATGCCTCTGTGCAGACAG AGTGAACATCAGACAAGGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 15, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!