ID: 1021845320_1021845338

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1021845320 1021845338
Species Human (GRCh38) Human (GRCh38)
Location 7:24757512-24757534 7:24757558-24757580
Sequence CCGCCGGGACCTTTGCTCGGTCC GGCCGCCGGAGGCTGCGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} {0: 1, 1: 0, 2: 4, 3: 34, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!