ID: 1021851608_1021851615

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1021851608 1021851615
Species Human (GRCh38) Human (GRCh38)
Location 7:24814176-24814198 7:24814212-24814234
Sequence CCCAAGCAGAAGGAAATGAAGAA CAGTGTGGCCAGAGGACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 73, 4: 687} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!