ID: 1021873140_1021873144

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1021873140 1021873144
Species Human (GRCh38) Human (GRCh38)
Location 7:25023252-25023274 7:25023305-25023327
Sequence CCACAGCTCACGCTTGTAAGTGA AGTTACTTCATTTAGAATAATGG
Strand - +
Off-target summary No data {0: 86, 1: 1135, 2: 1325, 3: 1170, 4: 2037}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!