ID: 1021884456_1021884466

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1021884456 1021884466
Species Human (GRCh38) Human (GRCh38)
Location 7:25125151-25125173 7:25125194-25125216
Sequence CCCACAGCTCTGCCTCTAACCAG TCTCACCTCTTTTTAGTCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 228} {0: 1, 1: 0, 2: 1, 3: 8, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!