ID: 1021902524_1021902525

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1021902524 1021902525
Species Human (GRCh38) Human (GRCh38)
Location 7:25300764-25300786 7:25300816-25300838
Sequence CCATGTGTAGTGAGAAGCGTGCT TTCTTCAAGTGACCAACTTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 37, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!