ID: 1021934928_1021934934

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1021934928 1021934934
Species Human (GRCh38) Human (GRCh38)
Location 7:25620895-25620917 7:25620924-25620946
Sequence CCAGCCACCACCACCTTATTCTG CATTTCCTCATCTGTAGAACAGG
Strand - +
Off-target summary No data {0: 3, 1: 19, 2: 213, 3: 1158, 4: 4728}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!