ID: 1021972765_1021972773

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1021972765 1021972773
Species Human (GRCh38) Human (GRCh38)
Location 7:25981664-25981686 7:25981695-25981717
Sequence CCTCTTTCCCTTTGCTAAGACAG TTGTTCGCTGTCCTCTAGCGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!