ID: 1022078883_1022078886

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1022078883 1022078886
Species Human (GRCh38) Human (GRCh38)
Location 7:27000303-27000325 7:27000338-27000360
Sequence CCCTGCTGTCTTCTGCAGATACT CACAGCTATTGGCCTGTTACTGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 197, 3: 203, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!