ID: 1022098065_1022098089

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1022098065 1022098089
Species Human (GRCh38) Human (GRCh38)
Location 7:27153034-27153056 7:27153077-27153099
Sequence CCCCGCGCCACCTACTGCAGTGC CCTGGTCTGCAGGCGGGGTGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 30, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!