ID: 1022099941_1022099950

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1022099941 1022099950
Species Human (GRCh38) Human (GRCh38)
Location 7:27163478-27163500 7:27163503-27163525
Sequence CCGCTTTGTGCGGGGATGGTGGA CTAGGGTGGGGGTGAGAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94} {0: 1, 1: 0, 2: 6, 3: 97, 4: 633}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!