ID: 1022101018_1022101033

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1022101018 1022101033
Species Human (GRCh38) Human (GRCh38)
Location 7:27169256-27169278 7:27169305-27169327
Sequence CCCCGGCGTCCGCGAAGGAGCAG AGGTGGAGGTGTGTGGTGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 86, 4: 923}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!