ID: 1022103807_1022103818

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1022103807 1022103818
Species Human (GRCh38) Human (GRCh38)
Location 7:27184601-27184623 7:27184629-27184651
Sequence CCGCCGCCGCCGCCGCGGAGGTC GGCCGCCGGGGGCCCCTTCTCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 37, 3: 258, 4: 2198} {0: 1, 1: 0, 2: 0, 3: 22, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!