ID: 1022109123_1022109130

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1022109123 1022109130
Species Human (GRCh38) Human (GRCh38)
Location 7:27217268-27217290 7:27217285-27217307
Sequence CCAGGATAAGTGTGTGTGTGTGT GTGTGTGTGGGGAAGGTGGTGGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 217, 3: 1226, 4: 5461} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!