ID: 1022142991_1022142993

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1022142991 1022142993
Species Human (GRCh38) Human (GRCh38)
Location 7:27509342-27509364 7:27509361-27509383
Sequence CCATGTCAAAGCCTAAGTTGTGT GTGTAGCAGCAGAAGCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 120} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!